Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV_PKbulge

PKB-number: PKB57
Definition: tRNA-like structure bulge pseudoknot of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV_PKbulge
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: J02415
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing; 3D-modelling
References: [1] Rietveld K. et al. (1984). EMBO J. 3:2613-2619.
[2] Mans R.M.W. et al. (1991). Eur.J.Biochem. 201:303-324.
[3] Felden B. et al. (1996). RNA 2:201-212.
Comment: This is the most extensively studied representative structure from tobamoviruses. The sequence is given for the so-called "strain vulgare".
Stem sizes:
Loop sizes:
7 4
4 34 7
Position Paired:
6291-6297; 6340-6346
6306-6309; 6336-6339
6315-6322; 6328-6335
6302-6305; 6354-6357
Bracket view of structure:
                  6300      6310      6320      6330      6340      6350
     #      123456789|123456789|123456789|123456789|123456789|123456789|1234567
     $ 6291 UGUGUCUUGGAUCGCGCGGGUCAAAUGUAUAUGGUUCAUAUACAUCCGCAGGCACGUAAUAAAGCGA=6357
     % 6291 (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-27 PKB00057.html