Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
AKV-MuLV

PKB-number: PKB78
Definition: Gag/pol translational readthrough site of AKV murine leukemia virus
Organism: AKV murine leukemia virus
Abbreviation: AKV-MuLV
RNA type: Viral Readthrough
Keywords: retrovirus type C; translational readthrough; gag-pol
EMBL number: J01998
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Wills N.M. et al. (1994). EMBO J. 13:4137-4144.
Stem sizes:
Loop sizes:
8 7
1 0 18
Position Paired:
2261-2264; 2282-2285
2265-2268; 2277-2280
2270-2276; 2304-2310
Bracket view of structure:
         2250      2260      2270      2280      2290      2300      2310
     #      |123456789|123456789|123456789|123456789|123456789|123456789|1
     $ 2250 UAGGGGGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCACUGUCGGGGGGCA=2311
     % 2250 :::::::::::((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-17 PKB00078.html