| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| AKV-MuLV | |||||
| PKB-number: | PKB78 |
| Definition: | Gag/pol translational readthrough site of AKV murine leukemia virus |
| Organism: | AKV murine leukemia virus |
| Abbreviation: | AKV-MuLV |
| RNA type: | Viral Readthrough |
| Keywords: | retrovirus type C; translational readthrough; gag-pol |
| EMBL number: | J01998 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Wills N.M. et al. (1994). EMBO J. 13:4137-4144. |
| Stem sizes: Loop sizes: |
8 7 1 0 18 |
| Position Paired: | 2261-2264; 2282-2285 2265-2268; 2277-2280 2270-2276; 2304-2310 |
| Bracket view of structure: |
2250 2260 2270 2280 2290 2300 2310
# |123456789|123456789|123456789|123456789|123456789|123456789|1
$ 2250 UAGGGGGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCACUGUCGGGGGGCA=2311
% 2250 :::::::::::((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]: