Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
GaLV

PKB-number: PKB79
Definition: Gag/pol translational readthrough site of gibbon ape leukemia virus
Organism: gibbon ape leukemia virus
Abbreviation: GaLV
RNA type: Viral Readthrough
Keywords: retrovirus type C; translational readthrough; gag-pol
EMBL number: M26927
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Wills N.M. et al. (1994). EMBO J. 13:4137-4144.
Stem sizes:
Loop sizes:
8 7
2 0 17
Position Paired:
2202-2209; 2219-2226
2212-2218; 2244-2250
Bracket view of structure:
                  2200      2210      2220      2230      2240      2250
     #      123456789|123456789|123456789|123456789|123456789|123456789|1
     $ 2191 UAGGGGAGUCAGGGUUCGGACCCCCUCCCCGAACCUAGGGUAACACUGACUGUGGAGGGGA=2251
     % 2191 :::::::::::((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-17 PKB00079.html