 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
MMTV_gag/pro |  |
|||
| PKB-number: | PKB80 |
| Definition: | Gag/pro ribosomal frameshift site of mouse mammary tumor virus |
| Organism: | mouse mammary tumor virus |
| Abbreviation: | MMTV_gag/pro |
| RNA type: | Viral Frameshift |
| Keywords: | retrovirus; ribosomal frameshift; gag-pro |
| EMBL number: | AF033807 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; NMR; Sequence comparison |
| References: |
[1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Chamorro M. et al. (1992). Proc.Natl.Acad.Sci.USA 89:713-717. [3] Shen L.X. & Tinoco I. (1995). J. Mol. Biol. 247:963-978. [4] Chen X. et al. (1996). J. Mol. Biol. 260:479-483. |
| Stem sizes: Loop sizes: |
5 7 1 1 8 |
| Position Paired: | 2090-2094; 2104-2108 2096-2102; 2117-2123 |
| Bracket view of structure: |
2080 2090 2100 2110 2120
# 6789|123456789|123456789|123456789|123456789|1234
$ 2076 AAAAAACUUGUAAAGGGGCAGUCCCCUAGCCCCGCUCAAAAGGGGGAUG=2124
% 2076 ::::::::::::::(((((:[[[[[[[:)))))::::::::]]]]]]]: