Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
MMTV_gag/pro

PKB-number: PKB80
Definition: Gag/pro ribosomal frameshift site of mouse mammary tumor virus
Organism: mouse mammary tumor virus
Abbreviation: MMTV_gag/pro
RNA type: Viral Frameshift
Keywords: retrovirus; ribosomal frameshift; gag-pro
EMBL number: AF033807
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; NMR; Sequence comparison
References: [1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Chamorro M. et al. (1992). Proc.Natl.Acad.Sci.USA 89:713-717.
[3] Shen L.X. & Tinoco I. (1995). J. Mol. Biol. 247:963-978.
[4] Chen X. et al. (1996). J. Mol. Biol. 260:479-483.
Stem sizes:
Loop sizes:
5 7
1 1 8
Position Paired:
2090-2094; 2104-2108
2096-2102; 2117-2123
Bracket view of structure:
             2080      2090      2100      2110      2120
     #      6789|123456789|123456789|123456789|123456789|1234
     $ 2076 AAAAAACUUGUAAAGGGGCAGUCCCCUAGCCCCGCUCAAAAGGGGGAUG=2124
     % 2076 ::::::::::::::(((((:[[[[[[[:)))))::::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00080.html