Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FeLV

PKB-number: PKB88
Definition: Gag/pol translational readthrough site of Feline leukemia virus
Organism: Feline leukemia virus
Abbreviation: FeLV
RNA type: Viral Readthrough
Keywords: retrovirus type C; translational readthrough; gag-pol
EMBL number: K01803
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Wills N.M. et al. (1994). EMBO J. 13:4137-4144.
Stem sizes:
Loop sizes:
8 6
3 0 18
Position Paired:
2196-2199; 2218-2221
2200-2203; 2213-2216
2207-2212; 2240-2245
Bracket view of structure:
              2190      2200      2210      2220      2230      2240
     #      56789|123456789|123456789|123456789|123456789|123456789|123456
     $ 2185 UAGGAGAGUCAGGGCCAGGACCCCCCCCCCUGAGCCCAGGAUAACCUUAAGAAUAGGGGGGC=2246
     % 2185 :::::::::::((((((((:::[[[[[[)))):))))::::::::::::::::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-17 PKB00088.html