 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
FeLV |  |
|||
| PKB-number: | PKB88 |
| Definition: | Gag/pol translational readthrough site of Feline leukemia virus |
| Organism: | Feline leukemia virus |
| Abbreviation: | FeLV |
| RNA type: | Viral Readthrough |
| Keywords: | retrovirus type C; translational readthrough; gag-pol |
| EMBL number: | K01803 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Wills N.M. et al. (1994). EMBO J. 13:4137-4144. |
| Stem sizes: Loop sizes: |
8 6 3 0 18 |
| Position Paired: | 2196-2199; 2218-2221 2200-2203; 2213-2216 2207-2212; 2240-2245 |
| Bracket view of structure: |
2190 2200 2210 2220 2230 2240
# 56789|123456789|123456789|123456789|123456789|123456789|123456
$ 2185 UAGGAGAGUCAGGGCCAGGACCCCCCCCCCUGAGCCCAGGAUAACCUUAAGAAUAGGGGGGC=2246
% 2185 :::::::::::((((((((:::[[[[[[)))):))))::::::::::::::::::]]]]]]: