Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BMV3

PKB-number: PKB134
Definition: tRNA-like structure 3'end pseudoknot of RNA3 of brome mosaic virus
Organism: brome mosaic virus
Abbreviation: BMV3
RNA type: Viral tRNA-like
Keywords: bromovirus; RNA 3'end; aminoacylation
EMBL number: V00099
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing; 3D-modelling
References: [1] Ahlquist P. et al. (1981). Cell 23:183-189.
[2] Rietveld K. et al. (1983). EMBO J. 2:1079-1085.
[3] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
[4] Felden B. et al. (1994). J. Mol. Biol. 235:508-531.
Comment: This is the most extensively studied tRNA-like structure from bromoviruses and related viruses. RNAs 1 and 2 of BMV contain similar structures. Subgenomic RNA 4 is derived from RNA 3, with the same 3'end.
Stem sizes:
Loop sizes:
13 6
2 0 31
Position Paired:
1985-1991; 2070-2076
1994-1999; 2008-2013
2002-2007; 2108-2113
2021-2026; 2031-2036
2039-2042; 2066-2069
2043-2049; 2055-2061
2078-2085; 2092-2099
Bracket view of structure:
                   1990      2000      2010      2020      2030      2040      2050
      #      123456789¦123456789¦123456789¦123456789¦123456789¦123456789¦123456789¦
      $ 1981 UCUAGGUGCCUUUGAGAGUUACUCUUUGCUCUCUUCGGAAGAACCCUUAGGGGUUCGUGCAUGGGCUUGC=2050
      % 1981 ::::(((((((::((((((::[[[[[[)))))):::::::((((((::::))))))::(((((((((((:
                   2060      2070      2080      2090      2100      2110
      #      123456789¦123456789¦123456789¦123456789¦123456789¦123456789¦1234567
      $ 2051 AUAGCAAGUCUUAGAAUGCGGGUACCGUACAGUGUUGAAAAACACUGUAAAUCUCUAAAAGAGACCA=2117
      % 2051 ::::)))))))::::))))))))))):((((((((::::::))))))))::::::::]]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 6-10-1999 PKB00134.html