 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BMV3 |  |
|||
| PKB-number: | PKB134 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA3 of brome mosaic virus |
| Organism: | brome mosaic virus |
| Abbreviation: | BMV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | bromovirus; RNA 3'end; aminoacylation |
| EMBL number: | V00099 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing; 3D-modelling |
| References: |
[1] Ahlquist P. et al. (1981). Cell 23:183-189.
[2] Rietveld K. et al. (1983). EMBO J. 2:1079-1085. [3] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. [4] Felden B. et al. (1994). J. Mol. Biol. 235:508-531. |
| Comment: | This is the most extensively studied tRNA-like structure from bromoviruses and related viruses. RNAs 1 and 2 of BMV contain similar structures. Subgenomic RNA 4 is derived from RNA 3, with the same 3'end. |
| Stem sizes: Loop sizes: |
13 6 2 0 31 |
| Position Paired: | 1985-1991; 2070-2076 1994-1999; 2008-2013 2002-2007; 2108-2113 2021-2026; 2031-2036 2039-2042; 2066-2069 2043-2049; 2055-2061 2078-2085; 2092-2099 |
| Bracket view of structure: |
1990 2000 2010 2020 2030 2040 2050
# 123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1981 UCUAGGUGCCUUUGAGAGUUACUCUUUGCUCUCUUCGGAAGAACCCUUAGGGGUUCGUGCAUGGGCUUGC=2050
% 1981 ::::(((((((::((((((::[[[[[[)))))):::::::((((((::::))))))::(((((((((((:
2060 2070 2080 2090 2100 2110
# 123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 2051 AUAGCAAGUCUUAGAAUGCGGGUACCGUACAGUGUUGAAAAACACUGUAAAUCUCUAAAAGAGACCA=2117
% 2051 ::::)))))))::::))))))))))):((((((((::::::))))))))::::::::]]]]]]::::