Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BBMV3

PKB-number: PKB135
Definition: tRNA-like structure 3'end pseudoknot of RNA3 of broad bean mottle virus
Organism: broad bean mottle virus
Abbreviation: BBMV3
RNA type: Viral tRNA-like
Keywords: bromovirus; RNA 3'end; aminoacylation
EMBL number: K01778
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Ahlquist P. et al. (1981). Cell 23:183-189.
[2] Rietveld K. et al. (1983). EMBO J. 2:1079-1085.
[3] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Comment: RNAs 1 and 2 of BBMV contain similar structures. Subgenomic RNA 4 is derived from RNA 3, with the same 3'end.
Stem sizes:
Loop sizes:
13 6
2 0 31
Position Paired:
153-159; 219-225
162-167; 176-181
170-175; 257-262
187-191; 214-218
193-198; 204-209
226-234; 239-247
Bracket view of structure:
                   160       170       180       190       200       210
      #     123456789|123456789|123456789|123456789|123456789|123456789|
      $ 151 AAGAUAUCUGUACCGUCUUCUCCCCGACGGUUUCAAUCCAUAGCUUCACGUUGUGUAGCG=210
      % 151 ::(((((((::((((((::[[[[[[)))))):::::(((((:((((((:::::)))))):
                   220       230       240       250       260
      #     123456789|123456789|123456789|123456789|123456789|123456
      $ 211 UAGGUGGAAGGUAUCGUGUGGUGUAUAAACACCACAUAGUCUCUUAGGGGAGACCA=266
      % 211 :::))))))))))))(((((((((::::))))))))):::::::::]]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-8 PKB00135.html