Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CCMV3

PKB-number: PKB136
Definition: tRNA-like structure 3'end pseudoknot of RNA3 of cowpea chlorotic mottle virus
Organism: cowpea chlorotic mottle virus
Abbreviation: CCMV3
RNA type: Viral tRNA-like
Keywords: bromovirus; RNA 3'end; aminoacylation
EMBL number: M28818
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Ahlquist P. et al. (1981). Cell 23:183-189.
[2] Rietveld K. et al. (1983). EMBO J. 2:1079-1085.
[3] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Comment: RNAs 1 and 2 of CCMV contain similar structures. Subgenomic RNA 4 is derived from RNA 3, with the same 3'end.
Stem sizes:
Loop sizes:
13 6
2 0 27
Position Paired:
2041-2047; 2130-2136
2050-2055; 2064-2069
2058-2063; 2164-2169
2077-2082; 2087-2092
2095-2099; 2125-2129
2100-2106; 2112-2118
2137-2144; 2149-2156
Bracket view of structure:
          2040      2050      2060      2070      2080      2090      2100
      #      |123456789|123456789|123456789|123456789|123456789|123456789|123456789
      $ 2040 AGCUGCCCUUGGGUUUUACUCCUUGAACCCUUCGGAAGAACUCUUUGGAGUUCGUACCAGUACCUCACAU=2109
      % 2040 :(((((((::((((((::[[[[[[)))))):::::::((((((::::))))))::((((((((((((:::
          2110      2120      2130      2140      2150      2160      2170
      #      |123456789|123456789|123456789|123456789|123456789|123456789|123
      $ 2110 AGUGAGGUAAUAAGACUGGUGGGCAGCGCCUAGUCGAAAGACUAGGUGAUCUCUAAGGAGACCA=2173
      % 2110 ::)))))))::::::))))))))))))((((((((::::)))))))):::::::]]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-8 PKB00136.html