| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| CCMV3 | |||||
| PKB-number: | PKB136 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA3 of cowpea chlorotic mottle virus |
| Organism: | cowpea chlorotic mottle virus |
| Abbreviation: | CCMV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | bromovirus; RNA 3'end; aminoacylation |
| EMBL number: | M28818 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Ahlquist P. et al. (1981). Cell 23:183-189.
[2] Rietveld K. et al. (1983). EMBO J. 2:1079-1085. [3] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. |
| Comment: | RNAs 1 and 2 of CCMV contain similar structures. Subgenomic RNA 4 is derived from RNA 3, with the same 3'end. |
| Stem sizes: Loop sizes: |
13 6 2 0 27 |
| Position Paired: | 2041-2047; 2130-2136 2050-2055; 2064-2069 2058-2063; 2164-2169 2077-2082; 2087-2092 2095-2099; 2125-2129 2100-2106; 2112-2118 2137-2144; 2149-2156 |
| Bracket view of structure: |
2040 2050 2060 2070 2080 2090 2100
# |123456789|123456789|123456789|123456789|123456789|123456789|123456789
$ 2040 AGCUGCCCUUGGGUUUUACUCCUUGAACCCUUCGGAAGAACUCUUUGGAGUUCGUACCAGUACCUCACAU=2109
% 2040 :(((((((::((((((::[[[[[[)))))):::::::((((((::::))))))::((((((((((((:::
2110 2120 2130 2140 2150 2160 2170
# |123456789|123456789|123456789|123456789|123456789|123456789|123
$ 2110 AGUGAGGUAAUAAGACUGGUGGGCAGCGCCUAGUCGAAAGACUAGGUGAUCUCUAAGGAGACCA=2173
% 2110 ::)))))))::::::))))))))))))((((((((::::)))))))):::::::]]]]]]::::