Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CMV3

PKB-number: PKB137
Definition: tRNA-like structure 3'end pseudoknot of RNA3 of cucumber mosaic virus
Organism: cucumber mosaic virus
Abbreviation: CMV3
RNA type: Viral tRNA-like
Keywords: cucumovirus; RNA 3'end; aminoacylation
EMBL number: M21464
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Ahlquist P. et al. (1981). Cell 23:183-189.
[2] Rietveld K. et al. (1983). EMBO J. 2:1079-1085.
[3] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Comment: RNAs 1 and 2 of CMV contain similar structures. Subgenomic RNA 4 is derived from RNA 3, with the same 3'end.
Stem sizes:
Loop sizes:
13 5
2 1 28
Position Paired:
2066-2072; 2154-2160
2075-2080; 2089-2094
2083-2087; 2189-2193
2102-2108; 2113-2119
2122-2125; 2150-2153
2126-2132; 2139-2145
2161-2168; 2173-2180
Bracket view of structure:
               2070      2080      2090      2100      2110      2120      2130
      #      56789|123456789|123456789|123456789|123456789|123456789|123456789|1234
      $ 2065 AGGUACCCUUGAAAUCACCUCCUAGAUUUCUUCGGAAGGGCUUCGUGAGAAGCUCGUGCACGGUAAUACA=2134
      % 2065 :(((((((::((((((::[[[[[:)))))):::::::(((((((::::)))))))::(((((((((((::
               2140      2150      2160      2170      2180      2190
      #      56789|123456789|123456789|123456789|123456789|123456789|1234567
      $ 2135 CUGAUAUUACCAAGAGUGCGGGUAUCGCCUGUGGUUUUCCACAGGUUCUCCAUAAGGAGACCA=2197
      % 2135 ::::)))))))::::)))))))))))((((((((::::))))))))::::::::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-8 PKB00137.html