Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
BSMVbeta |
PKB-number: | PKB138 |
Definition: | tRNA-like structure 3'end pseudoknot of RNA beta of barley stripe mosaic virus |
Organism: | barley stripe mosaic virus |
Abbreviation: | BSMVbeta |
RNA type: | Viral tRNA-like |
Keywords: | hordeivirus; RNA 3'end; aminoacylation |
EMBL number: | X03854 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison; Structure probing |
References: |
[1] Kozlov Y.V. et al. (1984). Nucleic Acids Res. 12:4001-4009.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. |
Comment: | RNA gamma of BSMV contains similar structure. |
Stem sizes: Loop sizes: |
14 5 2 1 27 |
Position Paired: | 3195-3202; 3246-3253 3205-3210; 3219-3224 3213-3217; 3281-3285 3229-3234; 3240-3245 3255-3260; 3266-3271 |
Bracket view of structure: |
3200 3210 3220 3230 3240 3250 # 456789|123456789|123456789|123456789|123456789|123456789|123 $ 3194 AUUGGUAUGUAAGCUACAACUUCCGGUAGCUGCGUCACACUUUAAGAGUGUGCAUACUGA=3253 % 3194 :((((((((::((((((::[[[[[:))))))::::((((((:::::)))))))))))))) 3260 3270 3280 # 456789|123456789|123456789|123456789 $ 3254 GCCGAAGCUCAGCUUCGGUCCCCCAAGGGAAGACCA=3289 % 3254 :((((((:::::)))))):::::::::]]]]]::::