Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSMVbeta

PKB-number: PKB138
Definition: tRNA-like structure 3'end pseudoknot of RNA beta of barley stripe mosaic virus
Organism: barley stripe mosaic virus
Abbreviation: BSMVbeta
RNA type: Viral tRNA-like
Keywords: hordeivirus; RNA 3'end; aminoacylation
EMBL number: X03854
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Kozlov Y.V. et al. (1984). Nucleic Acids Res. 12:4001-4009.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Comment: RNA gamma of BSMV contains similar structure.
Stem sizes:
Loop sizes:
14 5
2 1 27
Position Paired:
3195-3202; 3246-3253
3205-3210; 3219-3224
3213-3217; 3281-3285
3229-3234; 3240-3245
3255-3260; 3266-3271
Bracket view of structure:
                3200      3210      3220      3230      3240      3250
      #      456789|123456789|123456789|123456789|123456789|123456789|123
      $ 3194 AUUGGUAUGUAAGCUACAACUUCCGGUAGCUGCGUCACACUUUAAGAGUGUGCAUACUGA=3253
      % 3194 :((((((((::((((((::[[[[[:))))))::::((((((:::::))))))))))))))
                3260      3270      3280
      #      456789|123456789|123456789|123456789
      $ 3254 GCCGAAGCUCAGCUUCGGUCCCCCAAGGGAAGACCA=3289
      % 3254 :((((((:::::)))))):::::::::]]]]]::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-8 PKB00138.html