Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV-L_PKbulge

PKB-number: PKB139
Definition: tRNA-like structure bulge pseudoknot of the tomato strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV-L_PKbulge
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: X02144
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Rietveld K. et al. (1984). EMBO J. 3:2613-2619.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Stem sizes:
Loop sizes:
6 4
4 34 9
Position Paired:
6280-6285; 6328-6333
6294-6297; 6324-6327
6303-6310; 6316-6323
6290-6293; 6343-6346
Bracket view of structure:
           6280      6290      6300      6310      6320      6330      6340
     #      89|123456789|123456789|123456789|123456789|123456789|123456789|1234567
     $ 6278 UAGUGUCUUGGAGCGCGCGGAGUAAACAUAUAUGGUUCAUAUAUGUCCGUAGGCACGUAAAAAAAGCGAG=6347
     % 6278 ::((((((::::[[[[((((:::::((((((((:::::)))))))))))))))))):::::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-11 PKB00139.html