 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BYDV-NY-RPV |  |
|||
| PKB-number: | PKB46 |
| Definition: | ORF2/ORF3 (putative RNA-dependent RNA polymerase) ribosomal frameshift site of barley yellow dwarf virus, NY-RPV isolate |
| Organism: | barley yellow dwarf virus |
| Abbreviation: | BYDV-NY-RPV |
| RNA type: | Viral Frameshift |
| Keywords: | luteovirus; ribosomal frameshifting; RNA polymerase |
| EMBL number: | L25299 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Vincent JR et al. J.Gen.Virol. 1991, 72:2347-2355
[2] ten Dam EB. (1995). Ph.D.Thesis, Leiden University. |
| Stem sizes: Loop sizes: |
5 4 2 0 7 |
| Position Paired: | 1706-1710; 1717-1721 1713-1716; 1729-1732 |
| Bracket view of structure: |
1700 1710 1720 1730
# 456789|123456789|123456789|123456789|12
$ 1694 GGGAAACGGGAAGGCGGCGGCGUCCGCCGUAACAAACGC=1732
% 1694 ::::::::::::(((((::[[[[))))):::::::]]]]