Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Mo-MuLV

PKB-number: PKB47
Definition: Gag/pol translational readthrough site of Moloney murine leukemia virus
Organism: Moloney murine leukemia virus
Abbreviation: Mo-MuLV
RNA type: Viral Readthrough
Keywords: retrovirus type C; translational readthrough; gag-pol
EMBL number: AF033811
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] ten Dam,E. et al. Virus Genes 1990, 4:121-136.
[2] Wills NM, Gesteland RF & Atkins JF. EMBO J. 1994, 13:4137-4144.
Stem sizes:
Loop sizes:
8 7
1 0 18
Position Paired:
1982-1985; 2003-2006
1986-1989; 1998-2001
1991-1997; 2025-2031
Bracket view of structure:
                  1980      1990      2000      2010      2020      2030
     #      123456789|123456789|123456789|123456789|123456789|123456789|1
     $ 1971 UAGGGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGC=2031
     % 1971 :::::::::::((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-13/1999-6-17 PKB00047.html