Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SNV

PKB-number: PKB48
Definition: Gag/pol translational readthrough site of spleen necrosis virus
Organism: spleen necrosis virus
Abbreviation: SNV
RNA type: Viral Readthrough
Keywords: retrovirus type C; translational readthrough; gag-pol
EMBL number: M54993
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison.
References: [1] Wills NM, Gesteland RF & Atkins JF. EMBO J. 1994, 13:4137-4144.
Stem sizes:
Loop sizes:
7 7
2 0 18
Position Paired:
183-188; 202-207
190-190; 200-200
193-199; 226-232
Bracket view of structure:
                 180       190       200       210       220       230
     #     23456789|123456789|123456789|123456789|123456789|123456789|12
     $ 172 UAGGGCCGUCAGGGUUCUCCCGCCCUCCGUGAACCCAGGCUAAAAGUUAAGGUAGGGGGGC=232
     % 172 :::::::::::((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-5-17 PKB00048.html