Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BaEV

PKB-number: PKB98
Definition: Gag/pol translational readthrough site of baboon endogenous virus
Organism: baboon endogenous virus
Abbreviation: BaEV
RNA type: Viral Readthrough
Keywords: retrovirus type C; translational readthrough; gag-pol
EMBL number: D10032
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Wills N.M. et al. (1994). EMBO J. 13:4137-4144.
Stem sizes:
Loop sizes:
8 7
1 0 18
Position Paired:
2607-2612; 2626-2631
2614-2615; 2624-2625
2617-2623; 2650-2656
Bracket view of structure:
             2600      2610      2620      2630      2640      2650
     #      6789|123456789|123456789|123456789|123456789|123456789|1234567
     $ 2596 UAGGGGUGUCAGGGCUCUGGAGCCCCCCCCGAGCCCCGGCUAACUCUAUCUGUAGGGGGGCA=2657
     % 2596 :::::::::::((((((:((:[[[[[[[))))))))::::::::::::::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-17 PKB00098.html