 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BaEV |  |
|||
| PKB-number: | PKB98 |
| Definition: | Gag/pol translational readthrough site of baboon endogenous virus |
| Organism: | baboon endogenous virus |
| Abbreviation: | BaEV |
| RNA type: | Viral Readthrough |
| Keywords: | retrovirus type C; translational readthrough; gag-pol |
| EMBL number: | D10032 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] Wills N.M. et al. (1994). EMBO J. 13:4137-4144. |
| Stem sizes: Loop sizes: |
8 7 1 0 18 |
| Position Paired: | 2607-2612; 2626-2631 2614-2615; 2624-2625 2617-2623; 2650-2656 |
| Bracket view of structure: |
2600 2610 2620 2630 2640 2650
# 6789|123456789|123456789|123456789|123456789|123456789|1234567
$ 2596 UAGGGGUGUCAGGGCUCUGGAGCCCCCCCCGAGCCCCGGCUAACUCUAUCUGUAGGGGGGCA=2657
% 2596 :::::::::::((((((:((:[[[[[[[))))))))::::::::::::::::::]]]]]]]: