Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Cas-Br-E-MuLV

PKB-number: PKB99
Definition: Gag/pol translational readthrough site of Cas-Br-E murine leukemia virus
Organism: Cas-Br-E murine leukemia virus
Abbreviation: Cas-Br-E-MuLV
RNA type: Viral Readthrough
Keywords: retrovirus type C; translational readthrough; gag-pol
EMBL number: X57540
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Wills N.M. et al. (1994). EMBO J. 13:4137-4144.
Stem sizes:
Loop sizes:
8 7
1 0 18
Position Paired:
2239-2242; 2260-2263
2243-2246; 2255-2258
2248-2254; 2282-2288
Bracket view of structure:
           2230      2240      2250      2260      2270      2280      2290
     #      89|123456789|123456789|123456789|123456789|123456789|123456789|
     $ 2228 UAGGGGGGUCGGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCAA=2290
     % 2228 :::::::::::((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-17 PKB00099.html