Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SRV1_gag/pro

PKB-number: PKB107
Definition: Gag/pro ribosomal frameshift site of simian retrovirus-1
Organism: simian retrovirus-1
Abbreviation: SRV1_gag/pro
RNA type: Viral Frameshift
Keywords: retrovirus type D; ribosomal frameshifting; gag-pro
EMBL number: M11841
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; NMR; Sequence comparison; Structure probing
References: [1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] ten Dam E. et al. (1995). RNA 1:146-154.
[3] Du Z. et al. (1997). J. Mol. Biol. 270:464-470.
[4] Sung D. & Kang H. (1998). Nucleic Acids Res. 26:1369-1372.
Stem sizes:
Loop sizes:
6 6
1 0 12
Position Paired:
2337-2342; 2350-2355
2344-2349; 2368-2373
Bracket view of structure:
                2330      2340      2350      2360      2370
     #      3456789|123456789|123456789|123456789|123456789|1234
     $ 2323 GGGAAACGGACUGAGGGGCCAGCCCCAGGCCCCGAAACAAGCUUAUGGGGCG=2374
     % 2323 ::::::::::::::((((((:[[[[[[))))))::::::::::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-22 PKB00107.html