Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BEV

PKB-number: PKB128
Definition: ORF1a/ORF1b (polymerase) ribosomal frameshift site of Berne virus
Organism: Berne virus
Abbreviation: BEV
RNA type: Viral Frameshift
Keywords: torovirus; ribosomal frameshifting; polymerase
EMBL number: X52374
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Snijder E.J. et al. (1990). Nucleic Acids Res. 18:4535-4542.
Stem sizes:
Loop sizes:
11 5
4 0 69
Position Paired:
1057-1067; 1077-1087
1072-1076; 1157-1161
Bracket view of structure:
              1050      1060      1070      1080      1090
     #      56789|123456789|123456789|123456789|123456789|(59)
     $ 1045 UUUAAACUGUUGAGAGGUGCCUGGAGCGCCUGCAGGCAUCUCUGUU=1090
     % 1045 ::::::::::::(((((((((((::::[[[[[))))))))))):::
         1150      1160
     # (59) |123456789|12
     $ 1150 UAUAAUGCAGGCA=1162
     % 1150 :::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-24 PKB00128.html