Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
TRV-PSG |
PKB-number: | PKB130 |
Definition: | tRNA-like structure 3'end pseudoknot of RNA-2 of tobacco rattle virus (strain PSG) |
Organism: | tobacco rattle virus |
Abbreviation: | TRV-PSG |
RNA type: | Viral tRNA-like |
Keywords: | tobravirus; RNA 3'end |
EMBL number: | X03686 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison; Structure probing |
References: |
[1] van Belkum A. et al. (1987). Nucleic Acids Res.15:2837-2850.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. |
Stem sizes: Loop sizes: |
3 5 3 0 3 |
Position Paired: | 1881-1883; 1892-1894 1887-1891; 1898-1902 |
Bracket view of structure: |
1870 1880 1890 1900 # 6789|123456789|123456789|123456789|12345 $ 1866 AGGGGUAAAACCCCUCGCCUACGUAAGCGUUAUUACGCCC=1905 % 1866 :::::::::::::::(((:::[[[[[))):::]]]]]:::