Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TRV-PSG

PKB-number: PKB130
Definition: tRNA-like structure 3'end pseudoknot of RNA-2 of tobacco rattle virus (strain PSG)
Organism: tobacco rattle virus
Abbreviation: TRV-PSG
RNA type: Viral tRNA-like
Keywords: tobravirus; RNA 3'end
EMBL number: X03686
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] van Belkum A. et al. (1987). Nucleic Acids Res.15:2837-2850.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Stem sizes:
Loop sizes:
3 5
3 0 3
Position Paired:
1881-1883; 1892-1894
1887-1891; 1898-1902
Bracket view of structure:
             1870      1880      1890      1900
     #      6789|123456789|123456789|123456789|12345
     $ 1866 AGGGGUAAAACCCCUCGCCUACGUAAGCGUUAUUACGCCC=1905
     % 1866 :::::::::::::::(((:::[[[[[))):::]]]]]:::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-25 PKB00130.html