 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_23S-PKG12 |  |
|||
| PKB-number: | PKB148 |
| Definition: | The pseudoknot of the domain G (G12) of 23S ribosomal RNA |
| Organism: | Escherichia coli |
| Abbreviation: | Ec_23S-PKG12 |
| RNA type: | rRNA |
| Keywords: | ribosome; rRNA |
| EMBL number: | AF053964 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Leffers H. et al. (1987). J. Mol. Biol. 195:43-61.
[2] Gutell R.R. & Fox G.E. (1988). Nucleic Acids Res. 16:r175-r269. [3] De Rijk P. et al. (1999). Nucleic Acids Res. 27:174-178. |
| Comment: | The pseudoknot has been suggested on the basis of phylogenetic comparisons and is conserved in many 23S-like rRNAs [1,2]. The database of large subunit ribosomal RNAs [3]. |
| Stem sizes: Loop sizes: |
10 3 32 6 0 |
| Position Paired: | 2284-2285; 2383-2384 2288-2295; 2337-2344 2296-2297; 2321-2322 2299-2304; 2312-2317 2328-2330; 2385-2387 |
| Bracket view of structure: |
2290 2300 2310 2320 2330 2340
# 3456789|123456789|123456789|123456789|123456789|123456789|12345(36)
$ 2283 CACGAAGGUUGGCUAAUCCUGGUCGGACAUCAGGAGGUUAGUGCAAUGGCAUAAGCCAGCUUG=2345
% 2283 :((::((((((((((:((((((:::::::)))))):::)):::::[[[::::::)))))))):
2390
# (36) 23456789|
$ 2382 GGUCAUAGU=2390
% 2382 :))]]]:::