Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_23S-PKG12

PKB-number: PKB148
Definition: The pseudoknot of the domain G (G12) of 23S ribosomal RNA
Organism: Escherichia coli
Abbreviation: Ec_23S-PKG12
RNA type: rRNA
Keywords: ribosome; rRNA
EMBL number: AF053964
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Leffers H. et al. (1987). J. Mol. Biol. 195:43-61.
[2] Gutell R.R. & Fox G.E. (1988). Nucleic Acids Res. 16:r175-r269.
[3] De Rijk P. et al. (1999). Nucleic Acids Res. 27:174-178.
Comment: The pseudoknot has been suggested on the basis of phylogenetic comparisons and is conserved in many 23S-like rRNAs [1,2]. The database of large subunit ribosomal RNAs [3].
Stem sizes:
Loop sizes:
10 3
32 6 0
Position Paired:
2284-2285; 2383-2384
2288-2295; 2337-2344
2296-2297; 2321-2322
2299-2304; 2312-2317
2328-2330; 2385-2387
Bracket view of structure:
                 2290      2300      2310      2320      2330      2340
      #      3456789|123456789|123456789|123456789|123456789|123456789|12345(36)
      $ 2283 CACGAAGGUUGGCUAAUCCUGGUCGGACAUCAGGAGGUUAGUGCAAUGGCAUAAGCCAGCUUG=2345
      % 2283 :((::((((((((((:((((((:::::::)))))):::)):::::[[[::::::)))))))):
                  2390
      # (36) 23456789|
      $ 2382 GGUCAUAGU=2390
      % 2382 :))]]]:::     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-15 PKB00148.html