Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PRRSV-16244B

PKB-number: PKB218
Definition: ORF1a/ORF1b (polymerase) ribosomal frameshift site
Organism: Porcine reproductive and respiratory syndrome virus, North American isolate (16244B)
Abbreviation: PRRSV-16244B
RNA type: Viral Frameshift
Keywords: arterivirus; ribosomal frameshifting; polymerase
EMBL number: AF046869
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Allende R. et al. (1999). J. Gen. Virol. 80:307-315.
Stem sizes:
Loop sizes:
12 7
4 0 15
Position Paired:
7701-7706; 7731-7736
7708-7713; 7725-7730
7718-7724; 7752-7758
Bracket view of structure:
           7690      7700      7710      7720      7730      7740
      #      9|123456789|123456789|123456789|123456789|123456789|12345
      $ 7689 UUUAAACUGCUAGCCGCCAGCGGCUUGACCCGCUGUGGUCGCGGCGGCUUGGUUGUU=7745
      % 7689 ::::::::::::((((((:((((((::::[[[[[[[)))))))))))):::::::::
              7750      7760
      #      6789|123456789|
      $ 7746 ACUGAGACAGCGGUA=7760
      % 7746 ::::::]]]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-22 PKB00234.html