Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CrPV_IRES-PKI

PKB-number: PKB221
Definition: Pseudoknot PKI of the internal ribosomal entry site (IRES) region
Organism: Cricket paralysis virus
Abbreviation: CrPV_IRES-PKI
RNA type: Viral others
Keywords: Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus
EMBL number: AF218039
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274.
Stem sizes:
Loop sizes:
9 5
1 0 9
Position Paired:
6174-6179; 6197-6202
6183-6185; 6192-6194
6187-6191; 6212-6216
Bracket view of structure:
                 6180      6190      6200      6210
      #      3456789|123456789|123456789|123456789|1234567
      $ 6173 CGGUUUUUCAGAUUAGGUAGUCGAAAAACCUAAGAAAUUUACCUG=6217
      % 6173 :((((((:::(((:[[[[[)))::)))))):::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-17 PKB00221.html