Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PRRSV-LV

PKB-number: PKB233
Definition: ORF1a/ORF1b (polymerase) ribosomal frameshift site
Organism: Porcine reproductive and respiratory syndrome virus, European Lelystad strain (LV)
Abbreviation: PRRSV-LV
RNA type: Viral Frameshift
Keywords: arterivirus; ribosomal frameshifting; polymerase
EMBL number: M96262
Submitted by: A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Meulenberg J.J.M. et al. (1993). Virology 192:62-72.
Stem sizes:
Loop sizes:
12 7
4 0 15
Position Paired:
7402-7407; 7432-7437
7409-7414; 7426-7431
7419-7425; 7453-7459
Bracket view of structure:
          7390      7400      7410      7420      7430      7440      7450      7460
      #      |123456789|123456789|123456789|123456789|123456789|123456789|123456789|
      $ 7390 UUUAAACUGUUAGCCGCCAGCGGCUUGACCCGCUGUGGCCGCGGCGGCCUAGUUGUGACUGAAACGGCGGU=7460
      % 7390 ::::::::::::((((((:((((((::::[[[[[[[)))))))))))):::::::::::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2001-5-22 PKB00233.html