Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Mm_Edr

PKB-number: PKB257
Definition: Edr gene ribosomal frameshift signal
Organism: Mus musculus (mouse)
Abbreviation: Mm_Edr
RNA type: Viral Frameshift
Keywords: Mammalia; ribosomal frameshifting
EMBL number: AJ006464
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing;
References: [1] Manktelow E., Shigemoto K. & Brierley I. (2005). Nucleic Acids Res. 33:1553-1563.
Comment: This pseudoknot is a mammalian homologue of virus -1 ribosomal frameshifting signals
Stem sizes:
Loop sizes:
10 9
3 0 9
Position Paired:
1402-1406; 1432-1436
1407-1411; 1424-1428
1415-1423; 1446-1454
Bracket view of structure:
    1390      1400      1410      1420      1430      1440      1450
#      |123456789|123456789|123456789|123456789|123456789|123456789|12345
$ 1390 GGGAAACUCCCCGGCCCCGCUGUAGGGGGACCUUCAGCGACAGGGCCAGAACGAAUAAGGUCCCCA=1455
% 1390 ::::::::::::((((((((((:::[[[[[[[[[))))):::))))):::::::::]]]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00257.html