Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Hs_Ma3

PKB-number: PKB258
Definition: Ma3 gene ribosomal frameshift signal
Organism: Homo sapiens
Abbreviation: Hs_Ma3
RNA type: Viral Frameshift
Keywords: Mammalia; Ribosomal frameshifting
EMBL number: NM_013364
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Sequence comparison;
References: [1] Wills N.M. et al. (2006). J. Biol. Chem. 281:7082-7088.
Comment: This pseudoknot is a mammalian homologue of retroviral ribosomal frameshifting signals
Stem sizes:
Loop sizes:
11 5
3 1 10
Position Paired:
1687-1697; 1707-1717
1701-1705; 1728-1732
Bracket view of structure:
          1680      1690      1700      1710      1720      1730
#      456789|123456789|123456789|123456789|123456789|123456789|123
$ 1674 GGGAAACGGGAACUGGGCUUGGGACAAGAGCCAUCCCAAGUCCAAGGCCAAGUAGGCUCG=1733
% 1674 :::::::::::::(((((((((((:::[[[[[:)))))))))))::::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00258.html