Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Bs_glmS_P1.1

PKB-number: PKB276
Definition: The glmS ribozyme pseudoknot P1.1
Organism: Bacillus subtilis
Abbreviation: Bs_glmS_P1.1
RNA type: Ribozymes
Keywords: Bacteria; riboswitch; ribozyme
EMBL number: U21932
Submitted by: A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis; Sequence comparison;
References: [1] Soukup G.A. (2006). Nucleic Acids Res.34:968-975.
Comment: This structure is conserved in some of the Gram-positive bacteria [1].
Stem sizes:
Loop sizes:
5 5
37 13 0
Position Paired:
74-81; 94-101
111-115; 134-138
120-122; 126-128
69-73; 129-133
Bracket view of structure:
      70        80        90       100       110
#    89|123456789|123456789|123456789|123456789|
$ 68 CGCCCGAACUAAGCGCCCGGAAAAAGGCUUAGUUGACGAGGAU=110
% 68 :(((((((((((((::::::::::::)))))))):::::::::

             120       130       140
#     123456789|123456789|123456789|
$ 111 GGAGGUUAUCGAAUUUCGCGGAUCCUCCCG=140
% 111 [[[[[::::(((:::))))))))]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2007-5-17 PKB00276.html